PSAS, PSAS (genetic_marker) Pisum sativum | PulseDB

Marker Overview

Marker Overview


Name	PSAS
Genbank ID	Y13321
Type	SSR
Species	Pisum sativum
Repeat Motif	(AAT)6
Primer 1	PSAS.Forward Primer: ggtgataactatttggctcatc
Primer 2	PSAS.Reverse Primer: gtagatttctccattcacctg
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	Y13321

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
chr5LG3	supercontig	chr5LG3:277818658..277818886 .
Lcu.2RBY.Chr3	supercontig	Lcu.2RBY.Chr3:189990013..189990235 .

Publications


Year	Publication
2001	Burstin J, Deniot G, Potier J, Weinachter C, Aubert G, Baranger A. Microsatellite polymorphism in Pisum sativum. Plant breeding = Zeitschrift für Pflanzenzüchtung. 2001 Aug; 120(4):311-317.
2015	Jain S, Weeden NF, Kumar A, Chittem K, McPhee K. Functional Codominant Marker for Selecting the Fw Gene Conferring Resistance to Fusarium Wilt Race 1 in Pea. 2015; 55(6):2639-2646.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	pea-JI296xDP-RIL-2004	LGIII	N/A	118	PSAS	View
2	pea-PennantxPI595933-F2	LG3	N/A	320.2	PSAS	View