|
Marker Overview
Name | PsAS2 |
Genbank ID | Y13322 |
Type | CAPS |
Species | Pisum sativum |
Primer 1 | PsAS2.Forward Primer: CTAATCACACGTTTAGGACCGG |
Primer 2 | PsAS2.Reverse Primer: CGAAATCCAAACCGAACCTAATCC |
Restriction Enzyme | RsaI |
Publication | [view all] |
References
External references for this genetic_marker
Database | Accession |
DB:genbank | Y13322 |
Relationships
This genetic_marker is adjacent to the following primer feature(s):
Feature Name | Unique Name | Species | Type |
Forward Primer | PsAS2.Forward Primer | Pisum sativum | primer |
Reverse Primer | PsAS2.Reverse Primer | Pisum sativum | primer |
The following marker_locus feature(s) are an instance of this genetic_marker:
Publications
Year | Publication |
2006 | Aubert G, Morin J, Jacquin F, Loridon K, Quillet M, Petit A, Rameau C, Lejeune-Hénaut I, Huguet T, Burstin J. Functional mapping in pea, as an aid to the candidate gene selection and for investigating synteny with the model legume Medicago truncatula. Theoretical and applied genetics. 2006; 112(6):1024-1041. |
2015 | Sudheesh S, Rodda M, Kennedy P, Verma P, Leonforte A, Cogan NOI, Materne M, Forster JW, Kaur S. Construction of an integrated linkage map and trait dissection for bacterial blight resistance in field pea (Pisum sativum L.). 2015; 35:185. |
2014 | Klein A, Houtin H, Rond C, Marget P, Jacquin F, Boucherot K, Huart M, Riviere N, Boutet G, Lejeune-Henaut I, Burstin J. QTL analysis of frost damage in pea suggests different mechanisms involved in frost tolerance. Theoretical and Applied Genetics. 2014; 127(6):1319-1330. |
2016 | Ferrari B., Romani M., Aubert G., Boucherot K., Burstin J., Pecetti L., Huart-Naudet M., Klein A., Annicchiarico P. . Association of SNP Markers with Agronomic and Quality Traits of Field Pea in Italy. Czech Journal of Genetics and Plant Breeding. 2016; 52(3):83-93. |
|