PsAS2, PsAS2 (genetic_marker) Pisum sativum

Marker Overview
NamePsAS2
Genbank IDY13322
TypeCAPS
SpeciesPisum sativum
Primer 1PsAS2.Forward Primer: CTAATCACACGTTTAGGACCGG
Primer 2PsAS2.Reverse Primer: CGAAATCCAAACCGAACCTAATCC
Restriction EnzymeRsaI
Publication[view all]
References
External references for this genetic_marker
DatabaseAccession
DB:genbankY13322
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerPsAS2.Forward PrimerPisum sativumprimer
Reverse PrimerPsAS2.Reverse PrimerPisum sativumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
PsAS2PsAS2Pisum sativummarker_locus
PsAS2PsAS2-66.1Pisum sativummarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1pea-CameorxChina-RILLGIN/A44.6PsAS2View
2pea-compositeMap-2006LGIN/A61.7PsAS2View
3pea-consensusMap-2014LGIN/A41.5PsAS2View
4pea-consensusMap-2011LGIN/A65PsAS2View
5Pea-Integrated_Map-Sudheesh-2015LG1N/A194.63PsAS2View
6Pea-JI1491_x_Cameor-RILLG1N/A45.3PsAS2View
7Pea-Attika_x_Isard-RIL-2016LGIN/A79.2PsAS2View
8Pea-Kaspa_x_Attika-RIL-2016LGIN/A43.3PsAS2View
9Pea-Kaspa_x_Isard-RIL-2016LGIN/A59.6PsAS2View
10Pea-Consensus_RIL-2016LGIN/A59.3PsAS2View
11Pea-G0003973_x_Zhongwan6-F2LGIN/A66.1PsAS2-66.1View