PsC19558p107, PsC19558p107 (genetic_marker) Pisum sativum

Marker Overview
NamePsC19558p107
dbSNP IDN/A
TypeSNP
SNP AllelesN/A
5' Flanking SequenceGATAATGAGTTAGAAGCAGCAAAAAGAGATTATTTACAAGCTTCAATTGGAATCACAAAA
3' Flanking SequenceCAAACAAGATAATAATTCCAAAGTTGTTGGATTGGTATTTACTAGATTTTGCAAAGGATC
SpeciesPisum sativum
Publication[view all]
ContactThomas Warkentin
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
PsC19558p107PsC19558p107Pisum sativummarker_locus


Contact
NameDetails
Thomas Warkentin
First name:Thomas
Last name:Warkentin
Title:Researcher
Institution:University of Saskatchewan
Address:Crop Development Centre, University of Saskatchewan, 51 Campus Drive, Saskatoon, SK S7N 5A8, Canada
Country:Canada
Email:tom.warkentin@usask.ca
Last update:Nov 2019
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1pea-consensusMap-2014LGIVN/A56.09PsC19558p107View
2Pea-Integrated_Map-Sudheesh-2015LG4N/A198.26PsC19558p107View
3Pea-PR-19-RIL-2017LGI-IVAN/A53PsC19558p107View
4Pea-PR-19-RIL-2017LGI-IVBN/A6.2PsC19558p107View
5Pea-HIF-224-RIL-2017LGI-IVN/A14.2PsC19558p107View
6Pea-Consensus_GenoPea_array-2015LG04N/A54PsC19558p107View
Sequence
>PsC19558p107 ID=PsC19558p107|Name=PsC19558p107|organism=Pisum sativum|type=genetic_marker|length=121bp
GATAATGAGTTAGAAGCAGCAAAAAGAGATTATTTACAAGCTTCAATTGG
AATCACAAAAWCAAACAAGATAATAATTCCAAAGTTGTTGGATTGGTATT
TACTAGATTTTGCAAAGGATC