|
|
Marker Overview
| Name | PsMnSOD |
|---|
| Genbank ID | U30841 |
|---|
| Type | CAPS |
|---|
| Species | Pisum sativum |
|---|
| Primer 1 | PsMnSOD.Forward Primer: GCTCTCGAACAGCTTCACGAT |
|---|
| Primer 2 | PsMnSOD.Reverse Primer: CTTTGGTGGTTCACCACCTCC |
|---|
| Product Length | 750 |
|---|
| Restriction Enzyme | Sse91 |
|---|
| Publication | [view all] |
|---|
References
External references for this genetic_marker
| Database | Accession |
|---|
| DB:genbank | U30841 |
Publications
| Year | Publication |
|---|
| 2007 | Prioul-Gervais S, Deniot G, Receveur EM, Frankewitz A, Fourmann M, Rameau C, Pilet-Nayel ML, Baranger A. Candidate genes for quantitative resistance to Mycosphaerella pinodes in pea (Pisum sativum L.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2007 Apr; 114(6):971-84. |
| 2013 | Satovic Z, Avila CM, Cruz-Izquierdo S, Diaz-Ruiz R, Garcia-Ruiz M, Palomino C, Gutierrez N, Vitale S, Ocana-Moral S, Gutierrez MV, Cubero JI, Torres AM. A reference consensus genetic map for molecular markers and economically important traits in faba bean (Vicia faba L.). 2013; 14:932. |
| 2014 | Duarte J, Riviere N, Barabger A, Aubert G, Burstin J, Cornet L, Lavaud C, Lejeune-Henaut I, Martinant JP, Pichon JP, Pilet-Nayel ML, Boutet G. Transcriptome sequencing for high throughput SNP development and genetic mapping in Pea. BMC Genomics. 2014; 15:126. |
|
