PSU81288, PSU81288 (genetic_marker) Pisum sativum

Marker Overview
NamePSU81288
Genbank IDU81288
TypeSSR
SpeciesPisum sativum
Repeat Motif(AAC)8
Primer 1PSU81288.Forward Primer: cgccatggagcttagcttcc
Primer 2PSU81288.Reverse Primer: cgagtagatagaagaagatgc
Publication[view all]
References
External references for this genetic_marker
DatabaseAccession
DB:genbankU81288
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerPSU81288.Forward PrimerPisum sativumprimer
Reverse PrimerPSU81288.Reverse PrimerPisum sativumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
PSU81288PSU81288Pisum sativummarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1pea-TeresexChampagne-RIL-2009LG1N/A97.4PSU81288View
2pea-compositeMap-2006LGIN/A86.7PSU81288View
3pea-TeresexChampagne-RILLGI.2N/A70.6PSU81288View
4pea-TeresexK586-RILLGIb.1N/A12PSU81288View
5pea-consensusMap-2011LGIN/A73.7PSU81288View
6pea-microsatComposite-2005LGIN/A77PSU81288View
7pea-TeresexChampagne-RIL-2008LG1N/A97.4PSU81288View
8pea-PennantxPI595933-F2LG4N/A85PSU81288View
9pea-DSPx90-2131-RIL-2015LGIN/A83.1PSU81288View
10Pea-Composite_Map-RILLGIN/A70.6PSU81288View