RGA1.1, RGA1.1 (genetic_marker) Pisum sativum

Marker Overview
NameRGA1.1
Genbank IDAF123695
TypeRGA
SpeciesPisum sativum
Primer 1RGA1.1.Forward Primer: ATTTGTGTATCCGAGGATTTC
Primer 2RGA1.1.Reverse Primer: CTGCCAATTTCTTCTAGGTTT
Product Length419
Restriction EnzymeNlaIII
Publication[view all]
References
External references for this genetic_marker
DatabaseAccession
DB:genbankAF123695
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerRGA1.1.Forward PrimerPisum sativumprimer
Reverse PrimerRGA1.1.Reverse PrimerPisum sativumprimer