RGA2, RGA2 (genetic_marker) Pisum sativum

Marker Overview
NameRGA2
Genbank IDN/A
TypeRGA
SpeciesPisum sativum
Primer 1RGA2.Forward Primer: GCTACTGCTTTGTATGCTA
Primer 2RGA2.Reverse Primer: TCTTTTGTCAAGTATTAGTAA
Product Length449
Restriction EnzymeHpyF44III
Publication[view all]
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerRGA2.Forward PrimerPisum sativumprimer
Reverse PrimerRGA2.Reverse PrimerPisum sativumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
RGA2RGA2Pisum sativummarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1pea-consensusMap-2011LGVIIN/A57.4RGA2View
2pea-JI296xDP-F2:6-RILLG7N/A101RGA2View