RGA2.65, RGA2.65 (genetic_marker) Pisum sativum

Name	RGA2.65
Genbank ID	AF123699
Type	RGA
Species	Pisum sativum
Primer 1	RGA2.65.Forward Primer: TTGCGAAAGCCATCTACAAT
Primer 2	RGA2.65.Reverse Primer: TGCCAACTAAATAGCTCAAT
Product Length	403
Publication	[view all]

Database	Accession
DB:genbank	AF123699

Year	Publication
2007	Prioul-Gervais S, Deniot G, Receveur EM, Frankewitz A, Fourmann M, Rameau C, Pilet-Nayel ML, Baranger A. Candidate genes for quantitative resistance to Mycosphaerella pinodes in pea (Pisum sativum L.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2007 Apr; 114(6):971-84.