Rgp, Rgp (genetic_marker) Pisum sativum

Marker Overview
NameRgp
Genbank IDU31565
TypeCAPS
SpeciesPisum sativum
Primer 1Rgp.Forward Primer: GTATCTCCTTCAAGGATTCGGC
Primer 2Rgp.Reverse Primer: CCCAAATGGTCACAGATAACC
Restriction EnzymeHaeIII
Publication[view all]
References
External references for this genetic_marker
DatabaseAccession
DB:genbankU31565
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerRgp.Forward PrimerPisum sativumprimer
Reverse PrimerRgp.Reverse PrimerPisum sativumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
RgpRgpPisum sativummarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1pea-CameorxChina-RILLGIN/A64.8RgpView
2pea-compositeMap-2006LGIN/A123.3RgpView
3pea-consensusMap-2014LGIN/A56.9RgpView
4pea-consensusMap-2011LGIN/A93.6RgpView
5Pea-Integrated_Map-Sudheesh-2015LG1N/A159.98RgpView
6Pea-JI1491_x_Cameor-RILLG1N/A70RgpView
7Pea-Attika_x_Isard-RIL-2016LGIN/A110.4RgpView
8Pea-Kaspa_x_Attika-RIL-2016LGIN/A74.9RgpView
9Pea-Kaspa_x_Isard-RIL-2016LGIN/A78.2RgpView
10Pea-Consensus_RIL-2016LGIN/A90.5RgpView