Sbe2, Sbe2 (genetic_marker) Pisum sativum | PulseDB

Marker Overview

Marker Overview


Name	Sbe2
Genbank ID	X80010
Type	CAPS
Species	Pisum sativum
Primer 1	Sbe2.Forward Primer: CCCCGATGCTGATGGAAATCC
Primer 2	Sbe2.Reverse Primer: CTTTGGCCCACATCAAAGCCG
Restriction Enzyme	EcoRI HpaI
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	X80010

Publications


Year	Publication
2006	Aubert G, Morin J, Jacquin F, Loridon K, Quillet M, Petit A, Rameau C, Lejeune-Hénaut I, Huguet T, Burstin J. Functional mapping in pea, as an aid to the candidate gene selection and for investigating synteny with the model legume Medicago truncatula. Theoretical and applied genetics. 2006; 112(6):1024-1041.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	pea-compositeMap-2006	LGIII	N/A	9.8	Sbe2	View
2	pea-consensusMap-2011	LGIII	N/A	12.3	Sbe2	View
3	pea-NGB5839xJI1794-F2	LGIII	N/A	0	Sbe2	View