SNP_100000032, SNP_100000032 (genetic_marker) Pisum sativum

Marker Overview
NameSNP_100000032
dbSNP IDN/A
TypeSNP
SNP AllelesN/A
5' Flanking SequenceCTGTTTGTCCCGGTAAAAAATCCGGTGAAGTCTGCCGCACCGCCGTCCATATGCTTTCCG GTGGACAGACATATACTGAGACAGTTGGTCACAATTTTAC
3' Flanking SequenceCTGAATGCAACTTTTGATGAAATTGATCACACAAACTATGATGGGTTGTGGTTGCCGGGA GGAAGAGCGCCGGAGTATCTTGCTCACATTCCTAGTGTTG
SpeciesPisum sativum
Publication[view all]
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SNP_100000032SNP_100000032Pisum sativummarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Pea-Composite_Map-Sudheesh-2015LG3N/A125.44SNP_100000032View
2Pea-Kaspa_x_PBA Oura-RILLG3N/A73.7SNP_100000032View
Sequence
>SNP_100000032 ID=SNP_100000032|Name=SNP_100000032|organism=Pisum sativum|type=genetic_marker|length=201bp
CTGTTTGTCCCGGTAAAAAATCCGGTGAAGTCTGCCGCACCGCCGTCCAT
ATGCTTTCCGGTGGACAGACATATACTGAGACAGTTGGTCACAATTTTAC
RCTGAATGCAACTTTTGATGAAATTGATCACACAAACTATGATGGGTTGT
GGTTGCCGGGAGGAAGAGCGCCGGAGTATCTTGCTCACATTCCTAGTGTT
G