SNP_100000380, SNP_100000380 (genetic_marker) Pisum sativum

Marker Overview
NameSNP_100000380
dbSNP IDN/A
TypeSNP
SNP AllelesN/A
5' Flanking SequenceGATGGACACAGAAAGGAAACTCGTCGACACCCTTCTTCTTCATGCCAACATCGTAGATCC TGATCTTGGGATCAGGAACACCACGACAGAATCGTGACTT
3' Flanking SequenceGGGTATGGCTTGTTTTTAATTTGACGGTAACACCTTGCAGGTCTTCTTCCCATTGCGACG GCGCGATTTGTTC
SpeciesPisum sativum
Publication[view all]
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SNP_100000380SNP_100000380Pisum sativummarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1pea-KaspaxParafield-RILLGIIN/A183.8SNP_100000380View
2Pea-Integrated_Map-Sudheesh-2015LG2N/A204.75SNP_100000380View
3Pea-Composite_Map-Sudheesh-2015LG2N/A184.85SNP_100000380View
Sequence
>SNP_100000380 ID=SNP_100000380|Name=SNP_100000380|organism=Pisum sativum|type=genetic_marker|length=174bp
GATGGACACAGAAAGGAAACTCGTCGACACCCTTCTTCTTCATGCCAACA
TCGTAGATCCTGATCTTGGGATCAGGAACACCACGACAGAATCGTGACTT
WGGGTATGGCTTGTTTTTAATTTGACGGTAACACCTTGCAGGTCTTCTTC
CCATTGCGACGGCGCGATTTGTTC