SNP_100000556, SNP_100000556 (genetic_marker) Pisum sativum

Marker Overview
NameSNP_100000556
dbSNP IDN/A
TypeSNP
SNP AllelesN/A
5' Flanking SequenceCCCTAACCTCGCTCCTTATCATCTTCGCACTTCTTCCTCTGATTACCATAGCCATGTCGG ATTCCATCGATTCCGATTCTTCATCTTCTTCTGCTCCCGC
3' Flanking SequenceGTTCACATCATCTACACCGAAAAGCCTCAGGAAGAGGAGCCTGAAGCTTACCACATCCGA ACCCTCACTGCGGTTTTTGGCAGTGAGGAGGCTGCAAAAG
SpeciesPisum sativum
Publication[view all]
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SNP_100000556SNP_100000556Pisum sativummarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1pea-KaspaxParafield-RILLGIIN/A83.7SNP_100000556View
2Pea-Integrated_Map-Sudheesh-2015LG2N/A114.96SNP_100000556View
3Pea-Composite_Map-Sudheesh-2015LG2N/A85.18SNP_100000556View
Sequence
>SNP_100000556 ID=SNP_100000556|Name=SNP_100000556|organism=Pisum sativum|type=genetic_marker|length=201bp
CCCTAACCTCGCTCCTTATCATCTTCGCACTTCTTCCTCTGATTACCATA
GCCATGTCGGATTCCATCGATTCCGATTCTTCATCTTCTTCTGCTCCCGC
KGTTCACATCATCTACACCGAAAAGCCTCAGGAAGAGGAGCCTGAAGCTT
ACCACATCCGAACCCTCACTGCGGTTTTTGGCAGTGAGGAGGCTGCAAAA
G