SNP_100000830, SNP_100000830 (genetic_marker) Pisum sativum

Marker Overview
NameSNP_100000830
dbSNP IDN/A
TypeSNP
SNP AllelesN/A
5' Flanking SequenceCCTCCTCGACCTTTTGGCAGTAGTTCTTGATCAGTTTAACATTGTGTTCATTACCCTTCG ACTCTTCCTTCTGCTCAATTGATGACATAATACGCCATGA
3' Flanking SequenceGCTCTTCGTGCACCAATGACATTTTTATATCCAACTGAGAGGAGGTTCCTCTCTTCCACA GTTAGTTCAACATCAAGTTTCGCAACTTTCTTCATACATT
SpeciesPisum sativum
Publication[view all]
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SNP_100000830SNP_100000830Pisum sativummarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1pea-KaspaxParafield-RILLGIN/A112.6SNP_100000830View
2Pea-Composite_Map-Sudheesh-2015LG1N/A137.63SNP_100000830View
3Pea-Kaspa_x_PBA Oura-RILLG1N/A55.4SNP_100000830View
Sequence
>SNP_100000830 ID=SNP_100000830|Name=SNP_100000830|organism=Pisum sativum|type=genetic_marker|length=201bp
CCTCCTCGACCTTTTGGCAGTAGTTCTTGATCAGTTTAACATTGTGTTCA
TTACCCTTCGACTCTTCCTTCTGCTCAATTGATGACATAATACGCCATGA
RGCTCTTCGTGCACCAATGACATTTTTATATCCAACTGAGAGGAGGTTCC
TCTCTTCCACAGTTAGTTCAACATCAAGTTTCGCAACTTTCTTCATACAT
T