ThiolP, ThiolP (genetic_marker) Pisum sativum

Marker Overview
NameThiolP
AliasThiol
Genbank IDX66061
TypeCAPS
SpeciesPisum sativum
Primer 1ThiolP.Forward Primer: CCGAAGAGGATTACCCCTAYCGTGC
Primer 2ThiolP.Reverse Primer: GCTTCTCCCCAGCTACCACCCC
Restriction EnzymeMboII
Publication[view all]
References
External references for this genetic_marker
DatabaseAccession
DB:genbankX66061
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerThiolP.Forward PrimerPisum sativumprimer
Reverse PrimerThiolP.Reverse PrimerPisum sativumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
Fusarium root rot resistanceqFRR.DSPx90-2131.LGII.2002Pisum sativumQTL
Fusarium root rot resistanceqFRR.DSPx90-2131.LGII.2003Pisum sativumQTL
Fusarium root rot resistanceqFRR.DSPx90-2131.LGII.2004Pisum sativumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
ThiolPThiolPPisum sativummarker_locus
ThiolThiolPisum sativummarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1pea-CameorxChina-RILLGII_topN/A3.1ThiolPView
2pea-compositeMap-2006LGIIN/A4.6ThiolPView
3pea-consensusMap-2014LGIIN/A8.6ThiolPView
4pea-consensusMap-2011LGIIN/A4.6ThiolPView
5Pea-Integrated_Map-Sudheesh-2015LG2N/A8.6ThiolPView
6Pea-JI1491_x_Cameor-RILLG2N/A5.6ThiolPView
7Pea-Kaspa_x_Attika-RIL-2016LGIIN/A0ThiolPView
8Pea-Kaspa_x_Isard-RIL-2016LGIIN/A0ThiolPView
9Pea-Consensus_RIL-2016LGIIN/A0ThiolPView
10pea-DSPx90-2131-RIL-2015LGIIaN/A40.4ThiolView