|
Marker Overview
Name | WRI-33 |
Genbank ID | JN982283 |
Type | CAPS |
Species | Pisum sativum |
Primer 1 | WRI-33.Forward Primer: TGACCAAAGAGGAGTACTTGG |
Primer 2 | WRI-33.Reverse Primer: AGCACGTGCAGCTTCTTCTT |
Restriction Enzyme | BbvI |
Publication | [view all] |
References
External references for this genetic_marker
Database | Accession |
DB:genbank | JN982283 |
Publications
Year | Publication |
2012 | Weller JL, Liew LC, Hecht VF, Rajandran V, Laurie RE, Ridge S, Wenden B, Vander Schoor JK, Jaminon O, Blassiau C, Dalmais M, Rameau C, Bendahmane A, Macknight RC, Lejeune-Hénaut I. A conserved molecular basis for photoperiod adaptation in two temperate legumes. Proceedings of the National Academy of Sciences of the United States of America. 2012 Dec 18; 109(51):21158-63. |
|