|
|
Marker Overview
| Name | GAII8 |
|---|
| Genbank ID | N/A |
|---|
| Type | SSR |
|---|
| Species | Vicia faba |
|---|
| Repeat Motif | (CT)18CC(CT)3 |
|---|
| Primer 1 | GAII8.Forward Primer: GTTATTATTATGTACGCGCGTGC |
|---|
| Primer 2 | GAII8.Reverse Primer: GAATAAGCAGAAACGCGACGT |
|---|
| Product Length | 351 |
|---|
| Publication | [view all] |
|---|
Publications
| Year | Publication |
|---|
| 2010 | Díaz-Ruiz R, Torres AM, Satovic Z, Gutierrez MV, Cubero JI, Román B. Validation of QTLs for Orobanche crenata resistance in faba bean (Vicia faba L.) across environments and generations. Theoretical and applied genetics TAG. 2010; 120(5):909-919. |
| 2002 | Pozarkova D, Koblizkova A, Roman B, Torres AM, Lucretti S, Lysak M, Dolezel J, Macas J. Development and Characterization of Microsatellite Markers from Chromosome 1-Specific DNA Libraries of Vicia faba. 2002; 45(3):337-345. |
|
