GBSSR-VF-52, GBSSR-VF-52 (genetic_marker) Vicia faba

Marker Overview
NameGBSSR-VF-52
Genbank IDKC218624
TypeSSR
SpeciesVicia faba
Repeat Motif(CAG)5
Primer 1GBSSR-VF-52.Forward Primer: GGTTTCTTGTCCAAATAAGACG
Primer 2GBSSR-VF-52.Reverse Primer: TGCGATTCTGGAAATTGG
Product Length261
Publication[view all]
ContactMA El-Esawi
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKC218624
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerGBSSR-VF-52.Forward PrimerVicia fabaprimer
Reverse PrimerGBSSR-VF-52.Reverse PrimerVicia fabaprimer


Contact
NameDetails
MA El-Esawi
First name:MA
Last name:El-Esawi
Title:Researcher
Institution:Tanta University
Address:Botany Department, Faculty of Science, Tanta University, 31527 Tanta, Egypt
Country:Egypt
Email:mohamed.elesawi@science.tanta.edu.eg