GCSP, GCSP (genetic_marker) Vicia faba

Marker Overview
NameGCSP
Genbank IDAW127448
TypeCAPS
SpeciesVicia faba
Primer 1GCSP.Forward primer: GTAAAGAAACACTTGGCACCATTTTTAC
Primer 2GCSP.Reverse Primer: CCTCTTAAGTCAATAATGAACTCATGAGC
Restriction EnzymeHphI
Publication[view all]
References
External references for this genetic_marker
DatabaseAccession
DB:genbankAW127448
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerGCSP.Forward primerVicia fabaprimer
Reverse PrimerGCSP.Reverse PrimerVicia fabaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
GCSPGCSPVicia fabamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Pea-Integrated_Map-Sudheesh-2015LG2N/A23.23GCSPView
2Pea-JI1491_x_Cameor-RILLG2N/A10.2GCSPView
3Pea-Kaspa_x_Attika-RIL-2016LGIIN/A3.3GCSPView
4Pea-Kaspa_x_Isard-RIL-2016LGIIN/A4GCSPView
5Pea-Consensus_RIL-2016LGIIN/A3.3GCSPView
6faba-ConsensusMap_2013-RILLGIN/A574.87GCSPView
7Lupin-83A:476/P27255-RIL-2017LG03N/A89.8GCSPView
8Lupin-83A:476/P27255-RIL-2010LG03N/A85.4GCSPView