LG007, LG007 (genetic_marker) Vicia faba

Marker Overview
NameLG007
Genbank IDTC230161
TypeCAPS
SpeciesVicia faba
Primer 1LG007.Forward primer: TTGACGTTGATCTTTACAGCCAGG
Primer 2LG007.Reverse Primer: TGCAAGAAGAACCTCTTGGACCAG
Restriction EnzymeHindIII
Publication[view all]
ContactA.M. Torres
Contact
NameDetails
A.M. Torres
First name:A.
Last name:Torres
Title:Researcher
Institution:Departamento de Mejora y AgronomiHa
Address:C.I.F.A., Departamento de Mejora y AgronomiHa, Aptdo. 3092, E-14080 CoHrdoba, Spain
Country:Spain
Email:ge1toroa@uco.es
Fax:34-957-202721
References
External references for this genetic_marker
DatabaseAccession
DB:genbankTC230161
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1faba-29H_x_Vf136-RIL-2017LG10+Lg6+LG5N/A235.9LG007View
2faba-ConsensusMap_2013-RILLGIN/A25.07LG007View