Lup172, Lup172 (genetic_marker) Vicia faba | PulseDB

Marker Overview

Marker Overview


Name	Lup172-CAPS
Genbank ID	BG154039
Type	Indel
Species	Vicia faba
Primer 1	Lup172.Forward primer: attatcttagctatctctcccg
Primer 2	Lup172.Reverse Primer: catcaacagcattagttcct
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	BG154039

Publications


Year	Publication
2008	Ellwood SR, Phan HT, Jordan M, Hane J, Torres AM, Avila CM, Cruz-Izquierdo S, Oliver RP. Construction of a comparative genetic map in faba bean (Vicia faba L.); conservation of genome structure with Lens culinaris. BMC genomics. 2008; 9:380.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	faba-ConsensusMap_2013-RIL	LG03	N/A	43.05	Lup172	View