|
Marker Overview
Name | mtmt_GEN_00103_01_1 |
Genbank ID | N/A |
Type | EST marker |
Species | Medicago truncatula |
Primer 1 | mtmt_GEN_00103_01_1.Forward Primer: TAGAGCAGCAAGTGCTTCCA |
Primer 2 | mtmt_GEN_00103_01_1.Reverse Primer: CATCCATTGCTTTTCGCTTT |
Restriction Enzyme | AseI; HinfI |
Publication | [view all] |
Publications
Year | Publication |
2010 | Díaz-Ruiz R, Torres AM, Satovic Z, Gutierrez MV, Cubero JI, Román B. Validation of QTLs for Orobanche crenata resistance in faba bean (Vicia faba L.) across environments and generations. Theoretical and applied genetics TAG. 2010; 120(5):909-919. |
2013 | Satovic Z, Avila CM, Cruz-Izquierdo S, Diaz-Ruiz R, Garcia-Ruiz M, Palomino C, Gutierrez N, Vitale S, Ocana-Moral S, Gutierrez MV, Cubero JI, Torres AM. A reference consensus genetic map for molecular markers and economically important traits in faba bean (Vicia faba L.). 2013; 14:932. |
|