|
Marker Overview
Name | Pis_GEN_14_7_1 |
Genbank ID | N/A |
Type | EST marker |
Species | Pisum sativum |
Primer 1 | Pis_GEN_14_7_1.Forward Primer: ATGTCCTTCAAGGCGAGAGA |
Primer 2 | Pis_GEN_14_7_1.Reverse Primer: CCTGGTTCTTGGTGTCGATT |
Publication | [view all] |
Publications
Year | Publication |
2013 | Gutiérrez N, Palomino C, Satovic Z, Ruiz-Rodríguez MD, Vitale S, Gutiérrez MV, Rubiales D, Kharrat M, Amri M, Emeran AA, Cubero JI, Atienza SG, Torres AM, Avila CM. QTLs for Orobanche spp. resistance in faba bean: identification and validation across different environments. Molecular breeding. 2013; 32(4):909-922. |
2013 | Satovic Z, Avila CM, Cruz-Izquierdo S, Diaz-Ruiz R, Garcia-Ruiz M, Palomino C, Gutierrez N, Vitale S, Ocana-Moral S, Gutierrez MV, Cubero JI, Torres AM. A reference consensus genetic map for molecular markers and economically important traits in faba bean (Vicia faba L.). 2013; 14:932. |
|