Vf_Mt1g061800_001, Vf_Mt1g061800_001 (genetic_marker) Vicia faba

Marker Overview
NameVf_Mt1g061800_001
dbSNP IDN/A
TypeSNP
SNP AllelesY
5' Flanking SequenceTTCTGCTGGAAATCA
3' Flanking SequenceGCTCAAGGAGTTGCC
SpeciesVicia faba
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1faba-compositeMap-2015LGIIIN/A51.84Vf_Mt1g061800_001View
2faba-Côte d'Or 1_x_BeanPureLine4628-RIL-2016LG05N/A14.1Vf_Mt1g061800_001View
3Faba-CAB_integrated_map-2019LG03N/A45.79Vf_Mt1g061800_001View
4Faba-Disco/ILB938-F6-RILLG02N/A133.1Vf_Mt1g061800_001View
Sequence
>Vf_Mt1g061800_001 ID=Vf_Mt1g061800_001; Name=Vf_Mt1g061800_001; organism=Vicia faba; type=genetic_marker; length=183bp
GGTATTCTCATTTAAGCTCCGTGGAGCTTATAATATGATGGCAAAACTTC
CGGAGGAAGTCTTGGAGAAAGGGGTTATATGTTCTTCTGCTGGAAATCA[
Y]GCTCAAGGAGTTGCCTTGTCTGCCAAGAGATTGAATTGTAAYGCTGTT
ATTGCTATGCCCGTTACCACGCCTGACATCAAG