DK225b, DK225b (genetic_marker) Lens culinaris

Marker Overview
NameDK225b
AliasDK2252
Genbank IDDX918584
TypeCAPS
SpeciesLens culinaris
Primer 1DK225b.Forward Primer: TGCAGCTAAATCATATGCTCTGGC
Primer 2DK225b.Reverse Primer: TTGCTGAGAACCTGCTCTTGGTATG
Restriction EnzymeNlaIII
Publication[view all]
ContactSimon R. Ellwood
References
External references for this genetic_marker
DatabaseAccession
DB:genbankDX918533
DB:genbankDX918584
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerDK225b.Forward PrimerLens culinarisprimer
Reverse PrimerDK225b.Reverse PrimerLens culinarisprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
DK225bDK225bLens culinarismarker_locus
DK2252DK2252Lens culinarismarker_locus


Contact
NameDetails
Simon R. Ellwood
First name:Simon
Last name:Ellwood
Institution:Australian Centre for Nectrotropic Fungal Pathogens
Address:Australian Centre for Nectrotropic Fungal Pathogens, State Agricultural Biotechnology Centre, Department of Health Sciences, Murdoch University, Perth, WA 6150, Australia
Country:Australia
Email:s.ellwood@murdoch.edu.au
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1lentil-ILL5588xILL5722-F5-RILLGIN/A135.4DK225bView
2lentil-ILL5588xILL5722-F5-RIL-2012LGIN/A169.7DK2252View