GLLC607, GLLC607 (genetic_marker) Lens culinaris

Marker Overview
NameGLLC607
Genbank IDN/A
TypeSSR
SpeciesLens culinaris
Primer 1GLLC607.Forward Primer: AAGTTGTGGCCAAGAGGATT
Primer 2GLLC607.Reverse Primer: CCAAAACCCCCACTACTTTA
Publication[view all]
ContactGopesh Saha
Omar Idrissi
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerGLLC607.Forward PrimerLens culinarisprimer
Reverse PrimerGLLC607.Reverse PrimerLens culinarisprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
GLLC607GLLC607Lens culinarismarker_locus


Contact
NameDetails
Gopesh Saha
First name:Gopesh
Last name:Saha
Institution:USDA-ARS
Address:Grain Legume Genetics and Physiology Research Unit, USDA-ARS, Washington State University, Pullman, WA
Country:USA
Email:gopesh_saha@wsu.edu
Omar Idrissi
First name:Omar
Last name:Idrissi
Title:Researcher
Institution:Institut National de la Recherche Agronomique du Maroc
Address:Institut National de la Recherche Agronomique du Maroc (INRA), Centre Régional de Settat, P.O. Box 589, Settat, Morocco
Country:Belgium
Email:o.idrissi@yahoo.fr
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1lentil-ILL6002xILL5888-F7-RILLG1N/A78.2GLLC607View
2lentil-PrecozxL830-RILLG1N/A50.2GLLC607View
3Lentil_Precoz_x_L830_RILLG1N/A50.2GLLC607View
4Lentil-ILL6002_x_ILL5888-RIL-2016LGIN/A383.8GLLC607View