LcSSR528, LcSSR528 (genetic_marker) Lens culinaris

Marker Overview
NameLcSSR528
Genbank IDJF768693
TypeSSR
SpeciesLens culinaris
Repeat Motif(GA)9
Primer 1LcSSR528.Forward Primer: TCTCGCCAATACAACTCGAA
Primer 2LcSSR528.Reverse Primer: TCCCACCTGCAGTAGAAAAA
Product Length381
Publication[view all]
ContactSabhyata Bhatia
References
External references for this genetic_marker
DatabaseAccession
DB:genbankJF768693
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerLcSSR528.Forward PrimerLens culinarisprimer
Reverse PrimerLcSSR528.Reverse PrimerLens culinarisprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
LcSSR528LcSSR528Lens culinarismarker_locus


Contact
NameDetails
Sabhyata Bhatia
First name:Sabhyata
Last name:Bhatia
Title:Researcher
Institution:National Institute of Plant Genome Research
Address:Aruna Asaf Ali Marg, PO Box 10531, New Delhi 110067, India
Country:India
Email:sabhyata_bhatia@nipgr.res.in
Phone:91 11-26735159
Fax:91 11-26741658
Last update:Dec 2015
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1lentil-PrecozxL830-RILLG1N/A59.7LcSSR528View
2Lentil_Precoz_x_L830_RILLG1N/A59.7LcSSR528View