Lup302, Lup302 (genetic_marker) Lens culinaris

Marker Overview
NameLup302
AliasLup 302
Genbank IDDX918569
TypeCAPS
SpeciesLens culinaris
Primer 1Lup302.Forward: TTAGTTGGGAATACAGCACC
Primer 2Lup302.Forward Primer: ttagttgggaatacagcacc
Primer 3Lup302.Reverse: GGGACAAACAAATGTGAAGT
Primer 4Lup302.Reverse Primer: gggacaaacaaatgtgaagt
Restriction EnzymeTsp509I
Publication[view all]
ContactSimon R. Ellwood
Simon Ellwood
Comment2-cys peroxiredoxin
References
External references for this genetic_marker
DatabaseAccession
DB:genbankCA410731
DB:genbankDX918487
DB:genbankDX918569
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
ReverseLup302.ReverseLens culinarisprimer
ForwardLup302.ForwardLens culinarisprimer
Forward PrimerLup302.Forward PrimerLens culinarisprimer
Reverse PrimerLup302.Reverse PrimerLens culinarisprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Lup302Lup302Lens culinarismarker_locus


Contact
NameDetails
Simon R. Ellwood
First name:Simon
Last name:Ellwood
Institution:Australian Centre for Nectrotropic Fungal Pathogens
Address:Australian Centre for Nectrotropic Fungal Pathogens, State Agricultural Biotechnology Centre, Department of Health Sciences, Murdoch University, Perth, WA 6150, Australia
Country:Australia
Email:s.ellwood@murdoch.edu.au
Simon Ellwood
First name:Simon
Last name:Ellwood
Institution:Murdoch University
Country:Australia
Email:sellwood@murdoch.edu.au
Last update:May 2007
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1lentil-ILL5588xILL5722-F5-RILLGIN/A221.4Lup302View
2lentil-ILL5588xILL5722-F5-RIL-2012LGIN/A73.7Lup302View