|
Marker Overview
Name | Lup302-CAPS |
Genbank ID | CA410731 |
Type | CAPS |
Species | Lens culinaris |
Primer 1 | Lup302.Forward: TTAGTTGGGAATACAGCACC |
Primer 2 | Lup302.Forward Primer: ttagttgggaatacagcacc |
Primer 3 | Lup302.Reverse: GGGACAAACAAATGTGAAGT |
Primer 4 | Lup302.Reverse Primer: gggacaaacaaatgtgaagt |
Restriction Enzyme | Tsp509I |
Publication | [view all] |
Contact | Simon R. Ellwood Simon Ellwood
|
Comment | 2-cys peroxiredoxin |
References
External references for this genetic_marker
Database | Accession |
DB:genbank | DX918487 |
DB:genbank | DX918569 |
DB:genbank | CA410731 |
Publications
Year | Publication |
2007 | Phan HT, Ellwood SR, Hane JK, Ford R, Materne M, Oliver RP. Extensive macrosynteny between Medicago truncatula and Lens culinaris ssp. culinaris. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2007 Feb; 114(3):549-58. |
2006 | Nelson, MN, Phan HTT, Ellwood SR, Moolhuijzen PM, Hane J, Williams A, O'Lone CE, Fosu-Nyarko J, Scobie M, Cakir M, Jones MGK, Bellgard M, Ksiazkiewicz M, Wolko B, Barker SJ, Oliver RP, Cowling WA. The first gene-based map of Lupinus angustifolius L.-location of domestication genes and conserved synteny with Medicago truncatula. Theor Appl Genet. 2006; 113:225-238. |
|