PBA_LC_0612, PBA_LC_0612 (genetic_marker) Lens culinaris

Marker Overview
NamePBA_LC_0612
Genbank IDN/A
TypeEST-SSR
SpeciesLens culinaris
Repeat MotifTCT(4)
Primer 1PBA_LC_0612.Forward primer: AAGCAACATGTCTCAAACAAT
Primer 2PBA_LC_0612.Reverse primer: GAATTGCGATACTTCAACATC
Product Length145
Publication[view all]
ContactJohn W. Forster
Sukhjiwan Kaur
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerPBA_LC_0612.Forward primerLens culinarisprimer
Reverse primerPBA_LC_0612.Reverse primerLens culinarisprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
PBA_LC_0612PBA_LC_0612Lens culinarismarker_locus


Contact
NameDetails
John W. Forster
First name:John
Last name:Forster
Institution:La Trobe University Research and Development Park
Address:Bundoora, VIC 3083, Australia
Country:Australia
Email:john.forster@depi.vic.gov.au
Sukhjiwan Kaur
First name:Sukhjiwan
Last name:Kaur
Title:Researcher
Institution:La Trobe University
Address:Biosciences Research, Agriculture Victoria, AgriBio, La Trobe University, Bundoora, VIC, Australia
Country:Australia
Email:sukhjiwan.kaur@ecodev.vic.gov.au
Last update:Apr 2018
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Lentil-Consensus-RIL-2016LG1N/A172.72PBA_LC_0612View
2Lentil-Indianhead_x_Northfield-RIL-2016LG1N/A94.7PBA_LC_0612View
3Lentil- Northfield_x_Digger-RIL-2016LG1.2N/A86.4PBA_LC_0612View