PBA_LC_1288, PBA_LC_1288 (genetic_marker) Lens culinaris

Marker Overview
Genbank IDN/A
SpeciesLens culinaris
Repeat MotifAG(7)
Primer 1PBA_LC_1288.Forward primer: AGAAAGAGAACCCTTTGTGAC
Primer 2PBA_LC_1288.Reverse primer: ACGATGAAGAAGACGAAGAA
Product Length160
Publication[view all]
ContactJohn W. Forster
Dharmendra Singh

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerPBA_LC_1288.Forward primerLens culinarisprimer
Reverse primerPBA_LC_1288.Reverse primerLens culinarisprimer

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
PBA1288PBA1288Lens culinarismarker_locus

John W. Forster
First name:John
Last name:Forster
Institution:La Trobe University Research and Development Park
Address:Bundoora, VIC 3083, Australia
Dharmendra Singh
First name:Dharmendra
Last name:Singh
Institution:Indian Agricultural Research Institute
Address:Division of Genetics, Indian Agricultural Research Institute, New Delhi-12, India
Last update:Aug 2019
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer