|
Marker Overview
Name | PBA_LC_1288 |
Genbank ID | N/A |
Type | EST-SSR |
Species | Lens culinaris |
Repeat Motif | AG(7) |
Primer 1 | PBA_LC_1288.Forward primer: AGAAAGAGAACCCTTTGTGAC |
Primer 2 | PBA_LC_1288.Reverse primer: ACGATGAAGAAGACGAAGAA |
Product Length | 160 |
Publication | [view all] |
Contact | John W. Forster Dharmendra Singh
|
Relationships
This genetic_marker is adjacent to the following primer feature(s):
Feature Name | Unique Name | Species | Type |
Forward primer | PBA_LC_1288.Forward primer | Lens culinaris | primer |
Reverse primer | PBA_LC_1288.Reverse primer | Lens culinaris | primer |
The following marker_locus feature(s) are an instance of this genetic_marker:
Feature Name | Unique Name | Species | Type |
PBA1288 | PBA1288 | Lens culinaris | marker_locus |
Publications
Year | Publication |
2011 | Kaur S, Cogan NO, Pembleton LW, Shinozuka M, Savin KW, Materne M, Forster JW. Transcriptome sequencing of lentil based on second-generation technology permits large-scale unigene assembly and SSR marker discovery. BMC genomics. 2011; 12:265. |
2016 | SINGH D, SINGH CK, TOMAR RS, CHATURVEDI AK, SHAH D, KUMAR A, PAL M. Exploring genetic diversity for heat tolerance among lentil (Lens culinaris Medik.) genotypes of variant habitats by simple sequence repeat markers. Plant Breeding. 2016; (135)215-233. |
|