PBA_LC_1507, PBA_LC_1507 (genetic_marker) Lens culinaris

Marker Overview
NamePBA_LC_1507
Genbank IDN/A
TypeEST-SSR
SpeciesLens culinaris
Repeat MotifTGGAT(3)
Primer 1PBA_LC_1507.Forward primer: GACCGGAATATTCTCTGCTAT
Primer 2PBA_LC_1507.Reverse primer: TCAAGAATCACTCGTCAAAGT
Product Length147
Publication[view all]
ContactJohn W. Forster
Dharmendra Singh
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerPBA_LC_1507.Forward primerLens culinarisprimer
Reverse primerPBA_LC_1507.Reverse primerLens culinarisprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
PBA1507PBA1507Lens culinarismarker_locus


Contact
NameDetails
John W. Forster
First name:John
Last name:Forster
Institution:La Trobe University Research and Development Park
Address:Bundoora, VIC 3083, Australia
Country:Australia
Email:john.forster@depi.vic.gov.au
Dharmendra Singh
First name:Dharmendra
Last name:Singh
Title:Researcher
Institution:Indian Agricultural Research Institute
Address:Division of Genetics, Indian Agricultural Research Institute, New Delhi-12, India
Country:India
Email:dsingh_gen@iari.res.in
Last update:Aug 2019
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Lentil-JL-3/PDL-1-F2LG00N/A133.2PBA1507View