PLC16, PLC16 (genetic_marker) Lens culinaris

Marker Overview
NamePLC16
Genbank IDGT627608
TypeEST-SSR
SpeciesLens culinaris
Repeat Motif(T)10
Primer 1PLC16.forward primer: CGTTTGATCTTCTAAGCCCCTA
Primer 2PLC16.reverse primer: AAGGGAAAGGATGTTTGACTTG
Max Length270
Publication[view all]
ContactHarsh Dikshit
References
External references for this genetic_marker
DatabaseAccession
DB:genbankGT627608
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerPLC16.forward primerLens culinarisprimer
reverse primerPLC16.reverse primerLens culinarisprimer


Contact
NameDetails
Harsh Dikshit
First name:Harsh
Last name:Dikshit
Title:Researcher
Institution:Indian Agricultural Research Institute
Address:Division of Genetics, Indian Agricultural Research Institute, New Delhi 110012, India
Country:India
Email:harshgeneticsiari@gmail.com