PLC21, PLC21 (genetic_marker) Lens culinaris

Marker Overview
NamePLC21
Genbank IDGT626993
TypeEST-SSR
SpeciesLens culinaris
Repeat Motif(TTC)6
Primer 1PLC21.forward primer: AACTCGCATCCTCTTCACAACT
Primer 2PLC21.reverse primer: GGACCTTTCCCTTGTAGTCACC
Max Length286
Publication[view all]
ContactHarsh Dikshit
References
External references for this genetic_marker
DatabaseAccession
DB:genbankGT626993
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerPLC21.forward primerLens culinarisprimer
reverse primerPLC21.reverse primerLens culinarisprimer


Contact
NameDetails
Harsh Dikshit
First name:Harsh
Last name:Dikshit
Title:Researcher
Institution:Indian Agricultural Research Institute
Address:Division of Genetics, Indian Agricultural Research Institute, New Delhi 110012, India
Country:India
Email:harshgeneticsiari@gmail.com