|
Marker Overview
Name | PLC21 |
Genbank ID | GT626993 |
Type | EST-SSR |
Species | Lens culinaris |
Repeat Motif | (TTC)6 |
Primer 1 | PLC21.forward primer: AACTCGCATCCTCTTCACAACT |
Primer 2 | PLC21.reverse primer: GGACCTTTCCCTTGTAGTCACC |
Max Length | 286 |
Publication | [view all] |
Contact | Harsh Dikshit
|
References
External references for this genetic_marker
Database | Accession |
DB:genbank | GT626993 |
Publications
Year | Publication |
2013 | Jain N, Dikshit HK, Singh D, Singh A, Kumar H. Discovery of EST-derived microsatellite primers in the legume Lens culinaris (Fabaceae). Applications in plant sciences. 2013 Jul; 1(7). |
2017 | Singh A, Sharma V, Dikshit HK, Aski M, Kumar H, Thirunavukkarasu N, Patil BS, Kumar S, Sarker A. Association mapping unveils favorable alleles for grain iron and zinc concentrations in lentil (Lens culinaris subsp. culinaris). PloS one. 2017; 12(11):e0188296. |
|