PLC39, PLC39 (genetic_marker) Lens culinaris

Marker Overview
NamePLC39
Genbank IDGT624018
TypeEST-SSR
SpeciesLens culinaris
Repeat Motif(AAG)5
Primer 1PLC39.forward primer: CAGAGAAATCCCCTGCTGAG
Primer 2PLC39.reverse primer: CATGATTCCCATAGCCTTGC
Max Length178
Publication[view all]
ContactHarsh Dikshit
References
External references for this genetic_marker
DatabaseAccession
DB:genbankGT624018
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerPLC39.forward primerLens culinarisprimer
reverse primerPLC39.reverse primerLens culinarisprimer


Contact
NameDetails
Harsh Dikshit
First name:Harsh
Last name:Dikshit
Title:Researcher
Institution:Indian Agricultural Research Institute
Address:Division of Genetics, Indian Agricultural Research Institute, New Delhi 110012, India
Country:India
Email:harshgeneticsiari@gmail.com