|
Marker Overview
Name | PLC4 |
Genbank ID | N/A |
Type | EST-SSR |
Species | Lens culinaris |
Repeat Motif | (GGCAGC)3 |
Primer 1 | PLC4.forward primer: CCTATCGGGAAACTACATGGAA |
Primer 2 | PLC4.reverse primer: TCTGCATTGGTCTTCTTCTCAA |
Product Length | 359 |
Publication | [view all] |
Contact | Harsh Dikshit
|
Publications
Year | Publication |
2013 | Jain N, Dikshit HK, Singh D, Singh A, Kumar H. Discovery of EST-derived microsatellite primers in the legume Lens culinaris (Fabaceae). Applications in plant sciences. 2013 Jul; 1(7). |
2016 | Singh A, Dikshit HK, Singh D, Jain N, Aski M, Sarker A, Sharma TR. Use of expressed sequence tag microsatellite markers for exploring genetic diversity in lentil and related wild species. 2016; 1-16. |
|