PLC42, PLC42 (genetic_marker) Lens culinaris

Marker Overview
NamePLC42
Genbank IDGT626865
TypeEST-SSR
SpeciesLens culinaris
Repeat Motif(GA)8
Primer 1PLC42.forward primer: AACCAATCATGGCTTCTGCT
Primer 2PLC42.reverse primer: TTTCACCGTCTTTATGAACCA
Max Length210
Publication[view all]
ContactHarsh Dikshit
References
External references for this genetic_marker
DatabaseAccession
DB:genbankGT626865
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerPLC42.forward primerLens culinarisprimer
reverse primerPLC42.reverse primerLens culinarisprimer


Contact
NameDetails
Harsh Dikshit
First name:Harsh
Last name:Dikshit
Title:Researcher
Institution:Indian Agricultural Research Institute
Address:Division of Genetics, Indian Agricultural Research Institute, New Delhi 110012, India
Country:India
Email:harshgeneticsiari@gmail.com