PLC5, PLC5 (genetic_marker) Lens culinaris

Name	PLC5
Genbank ID	GT626272
Type	EST-SSR
Species	Lens culinaris
Repeat Motif	(CAATGG)
Primer 1	PLC5.forward primer: CATTGCAGCTTATTCTCACAGC
Primer 2	PLC5.reverse primer: TGACCCATCCTCATCCTTAAAT
Max Length	360
Publication	[view all]
Contact	Harsh Dikshit

Name	Details
Harsh Dikshit	First name: Harsh Last name: Dikshit Title: Researcher Institution: Indian Agricultural Research Institute Address: Division of Genetics, Indian Agricultural Research Institute, New Delhi 110012, India Country: India Email: harshgeneticsiari@gmail.com

Database	Accession
DB:genbank	GT626272

Year	Publication
2013	Jain N, Dikshit HK, Singh D, Singh A, Kumar H. Discovery of EST-derived microsatellite primers in the legume Lens culinaris (Fabaceae). Applications in plant sciences. 2013 Jul; 1(7).
2016	Singh A, Dikshit HK, Singh D, Jain N, Aski M, Sarker A, Sharma TR. Use of expressed sequence tag microsatellite markers for exploring genetic diversity in lentil and related wild species. 2016; 1-16.
2017	Singh A, Sharma V, Dikshit HK, Aski M, Kumar H, Thirunavukkarasu N, Patil BS, Kumar S, Sarker A. Association mapping unveils favorable alleles for grain iron and zinc concentrations in lentil (Lens culinaris subsp. culinaris). PloS one. 2017; 12(11):e0188296.