|
|
Marker Overview
| Name | PLC51 |
|---|
| Genbank ID | GT624642 |
|---|
| Type | EST-SSR |
|---|
| Species | Lens culinaris |
|---|
| Repeat Motif | (GAA)10 |
|---|
| Primer 1 | PLC51.forward primer: CCATGATGAGCCTTGAATGA |
|---|
| Primer 2 | PLC51.reverse primer: TCTTCAATCTCCAGGAACACTTT |
|---|
| Max Length | 143 |
|---|
| Publication | [view all] |
|---|
| Contact | Harsh Dikshit
|
|---|
References
External references for this genetic_marker
| Database | Accession |
|---|
| DB:genbank | GT624642 |
Publications
| Year | Publication |
|---|
| 2013 | Jain N, Dikshit HK, Singh D, Singh A, Kumar H. Discovery of EST-derived microsatellite primers in the legume Lens culinaris (Fabaceae). Applications in plant sciences. 2013 Jul; 1(7). |
| 2016 | Singh A, Dikshit HK, Singh D, Jain N, Aski M, Sarker A, Sharma TR. Use of expressed sequence tag microsatellite markers for exploring genetic diversity in lentil and related wild species. 2016; 1-16. |
| 2017 | Singh A, Sharma V, Dikshit HK, Aski M, Kumar H, Thirunavukkarasu N, Patil BS, Kumar S, Sarker A. Association mapping unveils favorable alleles for grain iron and zinc concentrations in lentil (Lens culinaris subsp. culinaris). PloS one. 2017; 12(11):e0188296. |
|
