PLC62, PLC62 (genetic_marker) Lens culinaris

Marker Overview
NamePLC62
Genbank IDN/A
TypeEST-SSR
SpeciesLens culinaris
Repeat Motif(AAAC)4
Primer 1PLC62.forward primer: GCAAAGAACAAGAATAACGTGG
Primer 2PLC62.reverse primer: CAAACCGAAGAATAAGAGAGGG
Product Length126
Publication[view all]
ContactHarsh Dikshit
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerPLC62.forward primerLens culinarisprimer
reverse primerPLC62.reverse primerLens culinarisprimer


Contact
NameDetails
Harsh Dikshit
First name:Harsh
Last name:Dikshit
Title:Researcher
Institution:Indian Agricultural Research Institute
Address:Division of Genetics, Indian Agricultural Research Institute, New Delhi 110012, India
Country:India
Email:harshgeneticsiari@gmail.com