PLC95, PLC95 (genetic_marker) Lens culinaris

Marker Overview
NamePLC95
Genbank IDN/A
TypeEST-SSR
SpeciesLens culinaris
Repeat Motif(GTT)6
Primer 1PLC95.Forward Primer: TTCATTCTTGGGCTAGGGA
Primer 2PLC95.Reverse Primer: TGCAGATGTGAAATACCTCAGT
Publication[view all]
ContactHarsh Dikshit
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerPLC95.Forward PrimerLens culinarisprimer
Reverse PrimerPLC95.Reverse PrimerLens culinarisprimer


Contact
NameDetails
Harsh Dikshit
First name:Harsh
Last name:Dikshit
Title:Researcher
Institution:Indian Agricultural Research Institute
Address:Division of Genetics, Indian Agricultural Research Institute, New Delhi 110012, India
Country:India
Email:harshgeneticsiari@gmail.com