SNP_20002180, SNP_20002180 (genetic_marker) Lens culinaris

Marker Overview
NameSNP_20002180
dbSNP IDN/A
TypeSNP
SNP AllelesN/A
5' Flanking SequenceTCAAGGTTCACGAGTTGAGGCAGAAAGCCAAAGCTGATCTGTTGAGTCAGTTGAAAGACC TCAAGGCTGAACTCGCTTTGCTCCGTGTTGCTAAGGTCAC
3' Flanking SequenceGGTGGTGCACCCAACAAGCTCTCCAAGATCAAGGTGGTGAGGCTGTCGATTGCTCAGGTT TTGACAGTGATTTCTCAGAAGCAGAAGGCTGCATTGAGGG
SpeciesLens culinaris
Publication[view all]
ContactJohn W. Forster
Sukhjiwan Kaur
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SNP_20002180SNP_20002180Lens culinarismarker_locus


Contact
NameDetails
John W. Forster
First name:John
Last name:Forster
Institution:La Trobe University Research and Development Park
Address:Bundoora, VIC 3083, Australia
Country:Australia
Email:john.forster@depi.vic.gov.au
Sukhjiwan Kaur
First name:Sukhjiwan
Last name:Kaur
Title:Researcher
Institution:La Trobe University
Address:Biosciences Research, Agriculture Victoria, AgriBio, La Trobe University, Bundoora, VIC, Australia
Country:Australia
Email:sukhjiwan.kaur@ecodev.vic.gov.au
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1lentil-CassabxILL2024-F6LG3N/A3.5SNP_20002180View
2Lentil-Consensus-RIL-2016LG1N/A11.1SNP_20002180View
3Lentil-Indianhead_x_Digger-RIL-2016LG1N/A10.3SNP_20002180View
4Lentil- Northfield_x_Digger-RIL-2016LG1N/A51.1SNP_20002180View
Sequence
>SNP_20002180 ID=SNP_20002180|Name=SNP_20002180|organism=Lens culinaris|type=genetic_marker|length=201bp
TCAAGGTTCACGAGTTGAGGCAGAAAGCCAAAGCTGATCTGTTGAGTCAG
TTGAAAGACCTCAAGGCTGAACTCGCTTTGCTCCGTGTTGCTAAGGTCAC
YGGTGGTGCACCCAACAAGCTCTCCAAGATCAAGGTGGTGAGGCTGTCGA
TTGCTCAGGTTTTGACAGTGATTTCTCAGAAGCAGAAGGCTGCATTGAGG
G