SSR13, SSR13 (genetic_marker) Lens culinaris

Name	SSR13
Genbank ID	N/A
Type	SSR
Species	Lens culinaris
Repeat Motif	(CA)6
Primer 1	SSR13.Forward Primer: GAAACAACACCGAAATACAC
Primer 2	SSR13.Reverse Primer: CGAAGTCAGATGAAGTTTG
Max Length	150
Publication	[view all]
Contact	Michael Baum

Name	Details
Michael Baum	First name: Michael Last name: Baum Institution: International Centre for Agricultural Research in the Dry Areas Address: ICARDA, PO Box 5466, Aleppo, Syria Country: Syria Email: M.Baum@cgiar.org

Year	Publication
2005	Hamwieh A, Udupa SM, Choumane W, Sarker A, Dreyer F, Jung C, Baum M. A genetic linkage map of Lens sp. based on microsatellite and AFLP markers and the localization of fusarium vascular wilt resistance. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2005 Feb; 110(4):669-77.

#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	lentil-CassabxILL2024-F6	LG4.1	N/A	97.3	SSR013	View
2	Lentil-Consensus-RIL-2016	LG2	N/A	247.03	SSR013	View
3	Lentil-Indianhead_x_Northfield-RIL-2016	LG2	N/A	110.7	SSR013	View
4	lentil-CDCRobinx964a-46-RIL	LG2	N/A	114.4	SSR13	View
5	lentil-CDCRobinx964a-46-RIL-2013	LG2	N/A	66.5	SSR13	View
6	lentil-EstonxPI320937-F8-RIL	LG1	N/A	114.1	SSR13	View
7	Lentil-CDC_Robin/964a-46-RIL-2017	LG02	N/A	90.4	SSR13	View
8	lentil-ILL5588xL692-16-1-RIL	LG1	N/A	14.2	SSR13B	View
9	lentil-ILL5588xL692-16-1-RIL	LG1	N/A	68.5	SSR13A	View