|
Marker Overview
Name | SSR317-1 |
Genbank ID | N/A |
Type | SSR |
Species | Lens culinaris |
Repeat Motif | (AT)4(GT)16(GC)6GTGGC(GT)5A(TG)8+(TAA)5 |
Primer 1 | SSR317-1.Forward Primer: GTGGGTGTAATTATTGCTAC |
Primer 2 | SSR317-1.Reverse Primer: GTATCAAACTTATGGTGAAATC |
Product Length | 308 |
Publication | [view all] |
Contact | Michael Baum Harsh Dikshit Sukhjiwan Kaur
|
Publications
Year | Publication |
2005 | Hamwieh A, Udupa SM, Choumane W, Sarker A, Dreyer F, Jung C, Baum M. A genetic linkage map of Lens sp. based on microsatellite and AFLP markers and the localization of fusarium vascular wilt resistance. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2005 Feb; 110(4):669-77. |
2017 | Singh A, Sharma V, Dikshit HK, Aski M, Kumar H, Thirunavukkarasu N, Patil BS, Kumar S, Sarker A. Association mapping unveils favorable alleles for grain iron and zinc concentrations in lentil (Lens culinaris subsp. culinaris). PloS one. 2017; 12(11):e0188296. |
2016 | Sudheesh S, Rodda MS, Davidson J, Javid M, Stephens A, Slater AT, Cogan NO, Forster JW, Kaur S. SNP-Based Linkage Mapping for Validation of QTLs for Resistance to Ascochyta Blight in Lentil. Frontiers in plant science. 2016; 7:1604. |
|