SSR80, SSR80 (genetic_marker) Lens culinaris

Marker Overview
NameSSR80
Genbank IDN/A
TypeSSR
SpeciesLens culinaris
Repeat Motif(TC)14(AC)12(AT)2
Primer 1SSR80.Forward Primer: CCATGCATACGTGACTGC
Primer 2SSR80.Reverse Primer: GTTGACTGTTGGTGTAAGTG
Product Length155
Max Length157
Publication[view all]
ContactMichael Baum
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerSSR80.Forward PrimerLens culinarisprimer
Reverse PrimerSSR80.Reverse PrimerLens culinarisprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SSR080SSR080Lens culinarismarker_locus
SSR80SSR80Lens culinarismarker_locus


Contact
NameDetails
Michael Baum
First name:Michael
Last name:Baum
Institution:International Centre for Agricultural Research in the Dry Areas
Address:ICARDA, PO Box 5466, Aleppo, Syria
Country:Syria
Email:M.Baum@cgiar.org
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1lentil-CassabxILL2024-F6LG4.1N/A171.6SSR080View
2Lentil-Consensus-RIL-2016LG2N/A337.75SSR080View
3Lentil-Indianhead_x_Northfield-RIL-2016LG2N/A185.8SSR080View
4Lentil-Indianhead_x_Digger-RIL-2016LG2.2N/A136SSR080View
5lentil-CDCRobinx964a-46-RIL-2013LG2N/A105.5SSR80View
6lentil-ILL5588xL692-16-1-RILLG1N/A15.8SSR80View
7lentil-PrecozxL830-RILLG1N/A45.4SSR80View
8Lentil_Precoz_x_L830_RILLG1N/A45.4SSR80View