|
Marker Overview
Name | SSR80 |
Genbank ID | N/A |
Type | SSR |
Species | Lens culinaris |
Repeat Motif | (TC)14(AC)12(AT)2 |
Primer 1 | SSR80.Forward Primer: CCATGCATACGTGACTGC |
Primer 2 | SSR80.Reverse Primer: GTTGACTGTTGGTGTAAGTG |
Product Length | 155 |
Max Length | 157 |
Publication | [view all] |
Contact | Michael Baum
|
Publications
Year | Publication |
2005 | Hamwieh A, Udupa SM, Choumane W, Sarker A, Dreyer F, Jung C, Baum M. A genetic linkage map of Lens sp. based on microsatellite and AFLP markers and the localization of fusarium vascular wilt resistance. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2005 Feb; 110(4):669-77. |
2016 | Idrissi O, Udupa M, De Keyser E, Van Damme P, De Riek J. Functional Genetic Diversity Analysis and Identification of Associated Simple Sequence Repeats and Amplified Fragment Length Polymorphism Markers to Drought Tolerance in Lentil (Lens culinaris ssp. culinaris Medicus) Landraces. Plant Molecular Biology Reporter. 2016; 2016(34):659-680. |
|