|
|
Marker Overview
| Name | GA4-SSR |
|---|
| Genbank ID | N/A |
|---|
| Type | SSR |
|---|
| Species | Vicia faba |
|---|
| Repeat Motif | (CT)16 |
|---|
| Primer 1 | GA4.Forward Primer: GAACTAAGGTGTACACGCGGG |
|---|
| Primer 2 | GA4.Reverse Primer: GGGGGGTAGATCTTGTTTTTTCC |
|---|
| Product Length | 232 |
|---|
| Publication | [view all] |
|---|
| Contact | A.M. Torres
|
|---|
Publications
| Year | Publication |
|---|
| 2002 | Pozarkova D, Koblizkova A, Roman B, Torres AM, Lucretti S, Lysak M, Dolezel J, Macas J. Development and Characterization of Microsatellite Markers from Chromosome 1-Specific DNA Libraries of Vicia faba. 2002; 45(3):337-345. |
| 2017 | Ocaña-Moral S, Gutiérrez N, Torres AM, Madrid E. Saturation mapping of regions determining resistance to Ascochyta blight and broomrape in faba bean using transcriptome-based SNP genotyping. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2017 Aug 08. |
|
