SSR10317, SSR10317 (genetic_marker) Vicia faba | PulseDB

Marker Overview

Marker Overview


Name	SSR10317
Genbank ID	N/A
Type	SSR
Species	Vicia faba
Repeat Motif	(ACA)12
Primer 1	SSR10317.Forward Primer: AATCATTCCGACCTTCACCA
Primer 2	SSR10317.Reverse Primer: GGTCAGCCATGTTGGTTTAGA
Product Length	140
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Lcu.2RBY.Chr2	supercontig	Lcu.2RBY.Chr2:33625231..33625361 .

Publications


Year	Publication
2013	Ma Y, Bao S, Yang T, Hu J, Guan J, He Y, Wang XJ, Wan Y, Sun X, Jiang J, Ging C, Zong X. Genetic linkage map of Chinese native variety faba bean (Vicia faba L.) based on simple sequence repeat markers. 2013; 132(4):397-400.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	faba-91825xK1563-F2	LG1	N/A	50.7	SSR10317	View
2	Faba-91825/K1563-F2-2019	LG04	N/A	168.77	SSR10317	View