PepTrans_Gene, PepTrans_Gene (genetic_marker) Pisum sativum | PulseDB

Marker Overview

Marker Overview


Name	PepTrans_Gene
Genbank ID	CD860432
Type	gene marker
Species	Pisum sativum
Primer 1	PepTrans_Gene.Forward Primer: CTGTCAAGGCCGTGATTCGGATC
Primer 2	PepTrans_Gene.Reverse Primer: CGGTCGTATAAAGGAATGACTAC
Restriction Enzyme	MboII
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	CD860432

Publications


Year	Publication
2015	Coyne CJ, Pilet-Nayel ML, McGee RJ, Porter LD, Smykal P, Grunwald NJ. Identification of QTL controlling high levels of partial resistance to Fusarium solani f. sp. pisi in pea. Plant Breeding. 2015.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	pea-DSPx90-2131-RIL-2015	LGIIa	N/A	64.4	PepTrans_Gene	View
2	pea-compositeMap-2006	LGII	N/A	19.3	PepTrans_Gene	View